Detail of EST/Unigene AW687388 |
Acc. | AW687388 |
Internal Acc. | NF009A12RT1F1088 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Farnesyl pyrophosphate synthase 1 OS=Lupinus albus E-value=2e-68; Farnesyl pyrophosphate synthase 2 OS=Lupinus albus E-value=7e-56; Farnesyl pyrophosphate synthase OS=Zea mays E-value=1e-52; Farnesyl pyrophosphate synthase OS=Helianthus annuus E-value=3e-50; Farnesyl pyrophosphate synthase OS=Artemisia annua E-value=5e-50; |
Length | 526 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | CAAAACAAAACTATTTCTTTCCACCCTCTTTCTTTCTCTCTCATTTCCATCAATGGCAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
EC | 2.5.1.1 2.5.1.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834828 |
Trichome-related Gene from Literature | N/A |