Detail of EST/Unigene AW687729 |
Acc. | AW687729 |
Internal Acc. | NF012G10RT1F1083 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 18 OS=Arabidopsis thaliana E-value=6e-57; Probable beta-1,3-galactosyltransferase 19 OS=Arabidopsis thaliana E-value=1e-56; Probable beta-1,3-galactosyltransferase 17 OS=Arabidopsis thaliana E-value=5e-54; Probable beta-1,3-galactosyltransferase 20 OS=Arabidopsis thaliana E-value=3e-41; Beta-1,3-galactosyltransferase 15 OS=Arabidopsis thaliana E-value=3e-07; |
Length | 428 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | GAGGATGAAAAGGTGTTAGTGTCACAGTTTATGATGGAGCTTCAAGGATTGAAGGTAGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843819 |
Trichome-related Gene from Literature | N/A |