Detail of EST/Unigene AW687901 |
Acc. | AW687901 |
Internal Acc. | NF014G03RT1F1023 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 18, mitochondrial OS=Arabidopsis thaliana E-value=4e-32; Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=1e-31; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=4e-28; Nudix hydrolase 21, chloroplastic OS=Arabidopsis thaliana E-value=1e-26; Nudix hydrolase 16, mitochondrial OS=Arabidopsis thaliana E-value=3e-18; |
Length | 337 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | CTCTTTTCTATATATATATATTCATCAATCAATTTGTTAGTTGAAATAAAGATATGGTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838051 |
Trichome-related Gene from Literature | N/A |