| Detail of EST/Unigene AW687901 |
| Acc. | AW687901 |
| Internal Acc. | NF014G03RT1F1023 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 18, mitochondrial OS=Arabidopsis thaliana E-value=4e-32; Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=1e-31; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=4e-28; Nudix hydrolase 21, chloroplastic OS=Arabidopsis thaliana E-value=1e-26; Nudix hydrolase 16, mitochondrial OS=Arabidopsis thaliana E-value=3e-18; |
| Length | 337 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DROOT; |
| Sequence | CTCTTTTCTATATATATATATTCATCAATCAATTTGTTAGTTGAAATAAAGATATGGTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838051 |
| Trichome-related Gene from Literature | N/A |