Detail of EST/Unigene AW687913 |
Acc. | AW687913 |
Internal Acc. | NF014H04RT1F1043 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Benzoate--CoA ligase, peroxisomal OS=Arabidopsis thaliana E-value=6e-48; Butyrate--CoA ligase AAE11, peroxisomal OS=Arabidopsis thaliana E-value=3e-47; Probable acyl-activating enzyme 12, peroxisomal OS=Arabidopsis thaliana E-value=1e-46; Probable acyl-activating enzyme 22 OS=Arabidopsis thaliana E-value=5e-45; Probable acyl-activating enzyme 8 OS=Arabidopsis thaliana E-value=3e-39; |
Length | 374 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | TGCTGATGTTGATGTGAAGAATCTTGAAACAATGGAGAGTGTGGTAAGAGATGGGAAAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01896 medium-chain acyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase |
EC | 6.2.1.12 6.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842900 |
Trichome-related Gene from Literature | N/A |