| Detail of EST/Unigene AW687913 |
| Acc. | AW687913 |
| Internal Acc. | NF014H04RT1F1043 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Benzoate--CoA ligase, peroxisomal OS=Arabidopsis thaliana E-value=6e-48; Butyrate--CoA ligase AAE11, peroxisomal OS=Arabidopsis thaliana E-value=3e-47; Probable acyl-activating enzyme 12, peroxisomal OS=Arabidopsis thaliana E-value=1e-46; Probable acyl-activating enzyme 22 OS=Arabidopsis thaliana E-value=5e-45; Probable acyl-activating enzyme 8 OS=Arabidopsis thaliana E-value=3e-39; |
| Length | 374 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DROOT; |
| Sequence | TGCTGATGTTGATGTGAAGAATCTTGAAACAATGGAGAGTGTGGTAAGAGATGGGAAAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01896 medium-chain acyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase |
| EC | 6.2.1.12 6.2.1.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842900 |
| Trichome-related Gene from Literature | N/A |