Detail of EST/Unigene AW687948 |
Acc. | AW687948 |
Internal Acc. | NF001C12ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 98A2 OS=Glycine max E-value=6e-60; Cytochrome P450 98A3 OS=Arabidopsis thaliana E-value=7e-47; Cytochrome P450 98A1 OS=Sorghum bicolor E-value=1e-43; Cytochrome P450 83A1 OS=Arabidopsis thaliana E-value=8e-17; Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=2e-15; |
Length | 431 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | ATCACAATGGCTCTGTTTCTCACAATACCCCTTTCATTCATAGCCATTTTCCTCTTTTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | ; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07415 cytochrome P450, family 2, subfamily E; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07415 cytochrome P450, family 2, subfamily E; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07415 cytochrome P450, family 2, subfamily E; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07415 cytochrome P450, family 2, subfamily E |
EC | 1.14.-.- 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818686 |
Trichome-related Gene from Literature | N/A |