Detail of EST/Unigene AW688230 |
Acc. | AW688230 |
Internal Acc. | NF005A01ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Tryptophan synthase beta chain 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-17; Tryptophan synthase beta chain 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-15; Tryptophan synthase beta chain 2, chloroplastic OS=Camptotheca acuminata E-value=3e-14; Tryptophan synthase beta chain 2, chloroplastic (Fragment) OS=Zea mays E-value=8e-13; Tryptophan synthase beta chain OS=Thermosynechococcus elongatus (strain BP-1) E-value=3e-07; |
Length | 447 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CCTNCTAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828815 |
Trichome-related Gene from Literature | N/A |