| Detail of EST/Unigene AW688585 |
| Acc. | AW688585 |
| Internal Acc. | NF009C08ST1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Translocon at the outer membrane of chloroplasts 64 OS=Pisum sativum E-value=0; Outer envelope protein 64, chloroplastic OS=Arabidopsis thaliana E-value=4e-80; Outer envelope protein 64, mitochondrial OS=Arabidopsis thaliana E-value=2e-58; Amidase 1 OS=Arabidopsis thaliana E-value=1e-56; Glutamyl-tRNA(Gln) amidotransferase subunit A OS=Legionella pneumophila (strain Corby) E-value=1e-18; |
| Length | 674 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | TCCTCATCCACTCACTTCCCTCACTTTCGCCATCTCCGACTTATTTGACATAGAAGGACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00632 Benzoate degradation via CoA ligation > K01426 amidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00643 Styrene degradation > K01426 amidase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K01426 amidase; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K01426 amidase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01426 amidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K01426 amidase |
| EC | 3.1.-.- 3.5.1.4 |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.9 Chloroplast protein translocating system (Tic-Toc) CEPT |
| Probeset |
|
| Corresponding NCBI Gene | 819660 |
| Trichome-related Gene from Literature | N/A |