| Detail of EST/Unigene AW688611 |
| Acc. | AW688611 |
| Internal Acc. | NF009E12ST1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4 glucan phosphorylase L isozyme, chloroplastic/amyloplastic OS=Vicia faba E-value=1e-68; Alpha-1,4 glucan phosphorylase L-1 isozyme, chloroplastic/amyloplastic OS=Solanum tuberosum E-value=6e-55; Alpha-1,4 glucan phosphorylase L-2 isozyme, chloroplastic/amyloplastic OS=Solanum tuberosum E-value=4e-54; Alpha-1,4 glucan phosphorylase L isozyme, chloroplastic/amyloplastic OS=Ipomoea batatas E-value=2e-52; Alpha-glucan phosphorylase, H isozyme OS=Arabidopsis thaliana E-value=3e-35; |
| Length | 675 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CTCTCTCTCATTGATCGATCTCAATTATGGCTTCCACGACAATGCGGTTACCAGACGAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00688 starch phosphorylase |
| EC | 2.4.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822590 |
| Trichome-related Gene from Literature | N/A |