| Detail of EST/Unigene AW688706 |
| Acc. | AW688706 |
| Internal Acc. | NF010F11ST1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Lotus japonicus E-value=3e-65; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Glycine max E-value=2e-64; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-55; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-50; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Glycine max E-value=5e-49; |
| Length | 705 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | AATTCAGCACGAGGTCACCACAGACCTGCCTCCGCCACCCAATCGCCGCCGCCGCTTCTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827960 |
| Trichome-related Gene from Literature | N/A |