| Detail of EST/Unigene AW688747 |
| Acc. | AW688747 |
| Internal Acc. | NF011B08ST1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-hydroxyisobutyryl-CoA hydrolase 1 OS=Arabidopsis thaliana E-value=1e-67; Probable 3-hydroxyisobutyryl-CoA hydrolase 3 OS=Arabidopsis thaliana E-value=3e-66; Probable 3-hydroxyisobutyryl-CoA hydrolase 2 OS=Arabidopsis thaliana E-value=5e-59; 3-hydroxyisobutyryl-CoA hydrolase-like protein 2, mitochondrial OS=Arabidopsis thaliana E-value=3e-40; 3-hydroxyisobutyryl-CoA hydrolase-like protein 1, mitochondrial OS=Arabidopsis thaliana E-value=6e-36; |
| Length | 681 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CTCCCTCAGTCTTCTTCACCAACGACCATGGCATCCCCCGCCAAACTGGATAAAGATCAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K05605 3-hydroxyisobutyryl-CoA hydrolase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K05605 3-hydroxyisobutyryl-CoA hydrolase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K05605 3-hydroxyisobutyryl-CoA hydrolase |
| EC | 3.1.2.4 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836724 |
| Trichome-related Gene from Literature | N/A |