Detail of EST/Unigene AW689021 |
Acc. | AW689021 |
Internal Acc. | NF014E02ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 2 OS=Arabidopsis thaliana E-value=4e-49; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=7e-47; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=1e-37; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=4e-37; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=3e-20; |
Length | 576 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CACTTTCATCACTTTTCATTTTTTCACTTCCTTTGGTTTTTATTTTCCACACACACACTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842942 |
Trichome-related Gene from Literature | N/A |