| Detail of EST/Unigene AW689121 |
| Acc. | AW689121 |
| Internal Acc. | NF015F03ST1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | N-alpha-acetyltransferase 35, NatC auxiliary subunit OS=Danio rerio E-value=2e-12; N-alpha-acetyltransferase 35, NatC auxiliary subunit OS=Mus musculus E-value=7e-12; N-alpha-acetyltransferase 35, NatC auxiliary subunit OS=Pongo abelii E-value=7e-12; N-alpha-acetyltransferase 35, NatC auxiliary subunit OS=Macaca fascicularis E-value=7e-12; N-alpha-acetyltransferase 35, NatC auxiliary subunit OS=Homo sapiens E-value=7e-12; |
| Length | 402 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CGATGTTTCTCCCCTCCTCCACGCCGCTTGCCAAGATCTTCATGAGGGAGACCTTATTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 815566 |
| Trichome-related Gene from Literature | N/A |