Detail of EST/Unigene AW689323 |
Acc. | AW689323 |
Internal Acc. | NF017H08ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin--nitrite reductase, chloroplastic OS=Betula pendula E-value=5e-86; Ferredoxin--nitrite reductase, chloroplastic OS=Arabidopsis thaliana E-value=2e-84; Ferredoxin--nitrite reductase, chloroplastic OS=Spinacia oleracea E-value=2e-82; Ferredoxin--nitrite reductase, chloroplastic (Fragment) OS=Zea mays E-value=1e-78; Ferredoxin--nitrite reductase, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-78; |
Length | 681 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CACACACTCTCTTCTCCAAAAATGTCTTCCTTCTCAGTACGTTTCCTCACTCCACCATCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816055 |
Trichome-related Gene from Literature | N/A |