Detail of EST/Unigene AW689371 |
Acc. | AW689371 |
Internal Acc. | NF018E01ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=8e-31; Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=2e-28; Lipoxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=3e-19; Linoleate 13S-lipoxygenase 3-1, chloroplastic OS=Solanum tuberosum E-value=5e-18; Lipoxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=9e-18; |
Length | 649 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | GCTCATGCAACAAATTAGTTTAAAGCCAAATTGTCTCATCTTGAACAACCCATGTCTCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838314 |
Trichome-related Gene from Literature | N/A |