| Detail of EST/Unigene AW689443 |
| Acc. | AW689443 |
| Internal Acc. | NF019C10ST1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--glyoxylate aminotransferase 1 OS=Arabidopsis thaliana E-value=1e-78; Glutamate--glyoxylate aminotransferase 2 OS=Arabidopsis thaliana E-value=4e-78; Probable alanine aminotransferase, mitochondrial OS=Dictyostelium discoideum E-value=3e-39; Putative alanine aminotransferase OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-35; Alanine aminotransferase 2 OS=Hordeum vulgare E-value=4e-34; |
| Length | 685 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CTCGGTGCTTCTTCTATCAATCTAAGGTTGTAATAACAACACACTGAACTATTCTGCAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00814 alanine transaminase |
| EC | 2.6.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838940 |
| Trichome-related Gene from Literature | N/A |