Detail of EST/Unigene AW689942 |
Acc. | AW689942 |
Internal Acc. | NF025F04ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carotene epsilon-monooxygenase, chloroplastic OS=Arabidopsis thaliana E-value=6e-40; Cytochrome P450 97B3, chloroplastic OS=Arabidopsis thaliana E-value=1e-12; Cytochrome P450 97B2, chloroplastic OS=Glycine max E-value=3e-12; Cytochrome P450 97B1, chloroplastic OS=Pisum sativum E-value=1e-10; Protein LUTEIN DEFICIENT 5, chloroplastic OS=Arabidopsis thaliana E-value=4e-10; |
Length | 467 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CGTAAACCCAAAAACAATGCCATCATGTTCATGTTCATGTTCATGTTCACTCCCTCTCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824479 |
Trichome-related Gene from Literature | N/A |