Detail of EST/Unigene AW689957 |
Acc. | AW689957 |
Internal Acc. | NF025G12ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoribulokinase, chloroplastic OS=Mesembryanthemum crystallinum E-value=1e-81; Phosphoribulokinase, chloroplastic OS=Triticum aestivum E-value=1e-76; Phosphoribulokinase, chloroplastic OS=Spinacia oleracea E-value=5e-76; Phosphoribulokinase, chloroplastic OS=Arabidopsis thaliana E-value=2e-75; Phosphoribulokinase, chloroplastic OS=Chlamydomonas reinhardtii E-value=1e-59; |
Length | 681 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | GAGAAAGAGAGAACAATAATATTGAGTGAGAATGGCAGCTTGTACTGTCTACTCAACACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840098 |
Trichome-related Gene from Literature | N/A |