Detail of EST/Unigene AW690086 |
Acc. | AW690086 |
Internal Acc. | NF028B10ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein RAC2 OS=Lotus japonicus E-value=2e-54; Rac-like GTP-binding protein 7 OS=Oryza sativa subsp. japonica E-value=1e-52; Rac-like GTP-binding protein RAC9 OS=Gossypium hirsutum E-value=3e-52; Rac-like GTP-binding protein 5 OS=Oryza sativa subsp. japonica E-value=3e-52; Rac-like GTP-binding protein ARAC2 OS=Arabidopsis thaliana E-value=4e-52; |
Length | 680 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CAATAATGTTCAAGTTAAAAGGAGTCACACTAAAGTTGGTGCCATAGGACTTGCCTTATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K07861 Ras-related C3 botulinum toxin substrate 3; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K07861 Ras-related C3 botulinum toxin substrate 3; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K07861 Ras-related C3 botulinum toxin substrate 3 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834637 |
Trichome-related Gene from Literature | N/A |