Detail of EST/Unigene AW690132 |
Acc. | AW690132 |
Internal Acc. | NF028C01ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NAD(P)H-quinone oxidoreductase subunit I, chloroplastic OS=Populus trichocarpa E-value=1e-16; NAD(P)H-quinone oxidoreductase subunit I, chloroplastic OS=Populus alba E-value=1e-16; NAD(P)H-quinone oxidoreductase subunit I, chloroplastic OS=Vitis vinifera E-value=1e-16; NAD(P)H-quinone oxidoreductase subunit I, chloroplastic OS=Nicotiana tabacum E-value=1e-16; NAD(P)H-quinone oxidoreductase subunit I, chloroplastic OS=Solanum tuberosum E-value=1e-16; |
Length | 255 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CGGAATCTGTATTTTTTGTGGTAACNTGTATTGAGTATTGCCCAACAAATTGTTTATCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |