| Detail of EST/Unigene AW690226 |
| Acc. | AW690226 |
| Internal Acc. | NF030F01ST1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aspartate aminotransferase OS=Aquifex aeolicus (strain VF5) E-value=3e-13; Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase OS=Arabidopsis thaliana E-value=6e-11; Aspartate aminotransferase OS=Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3) E-value=8e-11; Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase OS=Petunia hybrida E-value=4e-10; Aspartate aminotransferase OS=Pyrococcus abyssi (strain GE5 / Orsay) E-value=4e-10; |
| Length | 583 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CTATGTGATGCGGGGGATTCCGTGGTTATGTATGCTCCTTACTACTTCAATTCATACATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K00816 kynurenine-oxoglutarate transaminase |
| EC | 2.6.1.5 4.4.1.14 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844376 |
| Trichome-related Gene from Literature | N/A |