Detail of EST/Unigene AW690234 |
Acc. | AW690234 |
Internal Acc. | NF030G04ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, chloroplastic OS=Glycine max E-value=4e-31; Omega-6 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=3e-16; Omega-6 fatty acid desaturase, chloroplastic OS=Brassica napus E-value=2e-12; Omega-6 fatty acid desaturase, chloroplastic OS=Spinacia oleracea E-value=9e-12; |
Length | 349 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | AAAAAATGGCTTGCACCTCTGCAAATTCATTACTCCAATTAAAGGGTTCTTCATTCCAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829220 |
Trichome-related Gene from Literature | N/A |