Detail of EST/Unigene AW690304 |
Acc. | AW690304 |
Internal Acc. | NF029C12ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Citrate synthase, glyoxysomal OS=Cucurbita maxima E-value=7e-28; Citrate synthase 3, peroxisomal OS=Arabidopsis thaliana E-value=5e-26; Citrate synthase 2, peroxisomal OS=Arabidopsis thaliana E-value=7e-25; Citrate synthase 1, peroxisomal OS=Arabidopsis thaliana E-value=1e-22; Citrate synthase OS=Dictyostelium discoideum E-value=3e-11; |
Length | 405 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CAACAACAACGGAATCGAAGATGCACGACGCTGCACGGAACCGTTTATCCACCCTCACAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818879 |
Trichome-related Gene from Literature | N/A |