| Detail of EST/Unigene AW690400 |
| Acc. | AW690400 |
| Internal Acc. | NF033F06ST1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ketol-acid reductoisomerase, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-81; Ketol-acid reductoisomerase, chloroplastic OS=Pisum sativum E-value=3e-81; Ketol-acid reductoisomerase, chloroplastic OS=Arabidopsis thaliana E-value=6e-80; Ketol-acid reductoisomerase, chloroplastic OS=Spinacia oleracea E-value=4e-78; Ketol-acid reductoisomerase OS=Geobacillus thermodenitrificans (strain NG80-2) E-value=1e-15; |
| Length | 562 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | ATTCTTTCAAGGGGATTAAGCAGATTGGTGTCATTGGATGGGGTTCACAGGGACCTGCTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825030 |
| Trichome-related Gene from Literature | N/A |