| Detail of EST/Unigene AW690555 |
| Acc. | AW690555 |
| Internal Acc. | NF035H04ST1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase B, chloroplastic OS=Pisum sativum E-value=3e-16; Glyceraldehyde-3-phosphate dehydrogenase B, chloroplastic OS=Arabidopsis thaliana E-value=2e-10; Glyceraldehyde-3-phosphate dehydrogenase B, chloroplastic OS=Spinacia oleracea E-value=8e-09; |
| Length | 144 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | GCTATGGCCACTCATGCAGCTTTAGCTTCTACAAGAATCCCTACAAGCACAAGGTTTCCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840895 |
| Trichome-related Gene from Literature | N/A |