Detail of EST/Unigene AW690555 |
Acc. | AW690555 |
Internal Acc. | NF035H04ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase B, chloroplastic OS=Pisum sativum E-value=3e-16; Glyceraldehyde-3-phosphate dehydrogenase B, chloroplastic OS=Arabidopsis thaliana E-value=2e-10; Glyceraldehyde-3-phosphate dehydrogenase B, chloroplastic OS=Spinacia oleracea E-value=8e-09; |
Length | 144 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | GCTATGGCCACTCATGCAGCTTTAGCTTCTACAAGAATCCCTACAAGCACAAGGTTTCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840895 |
Trichome-related Gene from Literature | N/A |