Detail of EST/Unigene AW690933 |
Acc. | AW690933 |
Internal Acc. | NF038H07ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=2e-33; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=4e-33; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=1e-31; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=3e-30; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=2e-21; |
Length | 654 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CACTTCTATCATCGTCATCACCACCACCACCATGTCTATCACTTCCACCACTCCACTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835090 |
Trichome-related Gene from Literature | N/A |