Detail of EST/Unigene AW690935 |
Acc. | AW690935 |
Internal Acc. | NF034H06ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=2e-37; Cytochrome P450 750A1 OS=Pinus taeda E-value=4e-37; Cytochrome P450 71B22 OS=Arabidopsis thaliana E-value=3e-36; Cytochrome P450 71A2 OS=Solanum melongena E-value=4e-36; Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=3e-35; |
Length | 650 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CTAATTTCACACCAAAAGAAAGTCACAAAATCGACCAATTATGGAGCCAGTGCAATTATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07414 cytochrome P450, family 2, subfamily D |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822221 |
Trichome-related Gene from Literature | N/A |