| Detail of EST/Unigene AW690958 |
| Acc. | AW690958 |
| Internal Acc. | NF035A11ST1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thiamine thiazole synthase, chloroplastic OS=Citrus sinensis E-value=0; Thiamine thiazole synthase 2, chloroplastic OS=Vitis vinifera E-value=0; Thiamine thiazole synthase, chloroplastic OS=Arabidopsis thaliana E-value=0; Thiamine thiazole synthase 1, chloroplastic OS=Vitis vinifera E-value=0; Thiamine thiazole synthase 2, chloroplastic OS=Sorghum bicolor E-value=0; |
| Length | 652 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | GATATAAACACCTTCAAATTCGCACCCATCAAAGAATCCATCGTCTCTCGTGAAATGACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835567 |
| Trichome-related Gene from Literature | N/A |