Detail of EST/Unigene AW691088 |
Acc. | AW691088 |
Internal Acc. | NF037E12ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Lotus japonicus E-value=2e-57; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Glycine max E-value=7e-57; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=9e-49; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=7e-46; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Glycine max E-value=4e-44; |
Length | 649 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | TCATAAACCACCACACCCACCCATATCCTCACCACAGACCTGCCTCCGCCACCCAATCGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827960 |
Trichome-related Gene from Literature | N/A |