| Detail of EST/Unigene AW691103 |
| Acc. | AW691103 |
| Internal Acc. | NF037G03ST1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Zea mays E-value=2e-21; Transketolase, chloroplastic OS=Spinacia oleracea E-value=1e-20; Transketolase, chloroplastic OS=Solanum tuberosum E-value=2e-20; Transketolase 7 OS=Craterostigma plantagineum E-value=2e-20; Transketolase 10 OS=Craterostigma plantagineum E-value=4e-18; |
| Length | 159 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CTTTATGATGAGGTTATGAGATATAACCCCAAGAATCCGTTTTGGTTTAACCGTGATCGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819137 |
| Trichome-related Gene from Literature | N/A |