Detail of EST/Unigene AW691276 |
Acc. | AW691276 |
Internal Acc. | NF039G05ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=8e-29; Glucan endo-1,3-beta-glucosidase 2 OS=Arabidopsis thaliana E-value=7e-28; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=9e-27; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=8e-26; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=8e-24; |
Length | 555 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CATGCTCTCTCTTCTCTTAGAAACAAAGCATCACCATAACATGGCTTTTGTTGCATTCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835611 |
Trichome-related Gene from Literature | N/A |