| Detail of EST/Unigene AW691433 |
| Acc. | AW691433 |
| Internal Acc. | NF044G08ST1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Mannosyl-oligosaccharide 1,2-alpha-mannosidase MNS3 OS=Arabidopsis thaliana E-value=5e-33; Mannosyl-oligosaccharide 1,2-alpha-mannosidase MNS1 OS=Arabidopsis thaliana E-value=1e-07; Mannosyl-oligosaccharide 1,2-alpha-mannosidase MNS2 OS=Arabidopsis thaliana E-value=5e-07; Probable mannosyl-oligosaccharide alpha-1,2-mannosidase 1B OS=Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / FGSC A1164 / NRRL 181) E-value=1e-05; |
| Length | 648 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | GATTCTTGTTGTTGACGCGTTACATTCGATATGCTACATAGCTTCTTCTTCTTCTTCTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00513 High-mannose type N-glycan biosynthesis > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00510 N-Glycan biosynthesis > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase |
| EC | 3.2.1.113 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839879 |
| Trichome-related Gene from Literature | N/A |