Detail of EST/Unigene AW691549 |
Acc. | AW691549 |
Internal Acc. | NF046C04ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=6e-23; Probable beta-1,3-galactosyltransferase 3 OS=Arabidopsis thaliana E-value=5e-19; Probable beta-1,3-galactosyltransferase 4 OS=Arabidopsis thaliana E-value=9e-14; Probable beta-1,3-galactosyltransferase 1 OS=Arabidopsis thaliana E-value=2e-09; |
Length | 627 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CCAACGTCCCTTACCATACTTGCAAACAAGCTACACACCCAACACAACTCACATAGATAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839292 |
Trichome-related Gene from Literature | N/A |