| Detail of EST/Unigene AW691840 |
| Acc. | AW691840 |
| Internal Acc. | NF044F10ST1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase, mitochondrial OS=Bos taurus E-value=2e-62; Serine hydroxymethyltransferase, cytosolic OS=Pongo abelii E-value=3e-62; Serine hydroxymethyltransferase, cytosolic OS=Homo sapiens E-value=4e-62; Serine hydroxymethyltransferase, cytosolic OS=Oryctolagus cuniculus E-value=6e-62; Serine hydroxymethyltransferase, cytosolic OS=Mus musculus E-value=6e-62; |
| Length | 575 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CTTTCTTTCTTTCTTTTTTCATTCAGATTCATTTCCCACATTTCCAATTATGGATCCCGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
| EC | 2.1.2.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827027 |
| Trichome-related Gene from Literature | N/A |