Detail of EST/Unigene AW692180 |
Acc. | AW692180 |
Internal Acc. | NF048E11ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=1e-24; UDP-arabinopyranose mutase 3 OS=Arabidopsis thaliana E-value=5e-23; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=1e-21; Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=6e-21; UDP-arabinopyranose mutase 1 OS=Oryza sativa subsp. japonica E-value=1e-20; |
Length | 176 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CAACAACAATGGCTTCTTCATCCAAACCAACACCACTTCTCAAAGATGAACTCGACATCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820039 |
Trichome-related Gene from Literature | 820039 |