Detail of EST/Unigene AW692365 |
Acc. | AW692365 |
Internal Acc. | NF054H03ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=5e-46; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=6e-40; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=3e-35; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=8e-26; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=2e-25; |
Length | 547 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CTTAGTTTTGATTTCTCAGCCTTCATTTTTGGGTGAGAATGGCAATCTCTTCCTTCTGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817295 |
Trichome-related Gene from Literature | N/A |