| Detail of EST/Unigene AW692393 |
| Acc. | AW692393 |
| Internal Acc. | NF050H03ST1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Histidinol-phosphate aminotransferase, chloroplastic OS=Nicotiana plumbaginifolia E-value=1e-13; Histidinol-phosphate aminotransferase, chloroplastic OS=Nicotiana tabacum E-value=1e-13; Histidinol-phosphate aminotransferase 2, chloroplastic OS=Arabidopsis thaliana E-value=5e-11; Histidinol-phosphate aminotransferase 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-11; |
| Length | 308 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CCAGTTCAGAGAGACATACGAACACAGACAGACAGACAACCCTTGTTTGTTAAAATGGGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830897 |
| Trichome-related Gene from Literature | N/A |