Detail of EST/Unigene AW692393 |
Acc. | AW692393 |
Internal Acc. | NF050H03ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Histidinol-phosphate aminotransferase, chloroplastic OS=Nicotiana plumbaginifolia E-value=1e-13; Histidinol-phosphate aminotransferase, chloroplastic OS=Nicotiana tabacum E-value=1e-13; Histidinol-phosphate aminotransferase 2, chloroplastic OS=Arabidopsis thaliana E-value=5e-11; Histidinol-phosphate aminotransferase 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-11; |
Length | 308 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CCAGTTCAGAGAGACATACGAACACAGACAGACAGACAACCCTTGTTTGTTAAAATGGGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830897 |
Trichome-related Gene from Literature | N/A |