Detail of EST/Unigene AW692497 |
Acc. | AW692497 |
Internal Acc. | NF052C04ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=4e-51; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=6e-37; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=3e-35; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum lycopersicum E-value=2e-34; Oxygen-evolving enhancer protein 2-1, chloroplastic OS=Nicotiana tabacum E-value=4e-34; |
Length | 480 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | AGAAAAATAAACTATACTAGACTCTAGCAAAATGGCCTCTACACAATGCTTCTTGCACCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837178 |
Trichome-related Gene from Literature | N/A |