Detail of EST/Unigene AW692623 |
Acc. | AW692623 |
Internal Acc. | NF057F02ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase B, chloroplastic OS=Pisum sativum E-value=1e-39; Glyceraldehyde-3-phosphate dehydrogenase B, chloroplastic OS=Spinacia oleracea E-value=5e-28; Glyceraldehyde-3-phosphate dehydrogenase B, chloroplastic OS=Arabidopsis thaliana E-value=6e-25; Glyceraldehyde-3-phosphate dehydrogenase B, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=3e-18; |
Length | 472 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CTCATTCCATTACTCCCCCAGCAACCATAATTTTCTTTTTCTCAAGATATTAACCACTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840895 |
Trichome-related Gene from Literature | N/A |