| Detail of EST/Unigene AW692623 |
| Acc. | AW692623 |
| Internal Acc. | NF057F02ST1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase B, chloroplastic OS=Pisum sativum E-value=1e-39; Glyceraldehyde-3-phosphate dehydrogenase B, chloroplastic OS=Spinacia oleracea E-value=5e-28; Glyceraldehyde-3-phosphate dehydrogenase B, chloroplastic OS=Arabidopsis thaliana E-value=6e-25; Glyceraldehyde-3-phosphate dehydrogenase B, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=3e-18; |
| Length | 472 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CTCATTCCATTACTCCCCCAGCAACCATAATTTTCTTTTTCTCAAGATATTAACCACTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840895 |
| Trichome-related Gene from Literature | N/A |