Detail of EST/Unigene AW692863
Acc. AW692863
Internal Acc. NF060D06ST1F1057
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Cell division cycle protein 48 homolog OS=Glycine max E-value=5e-08; Cell division cycle protein 48 homolog OS=Capsicum annuum E-value=5e-08; Cell division control protein 48 homolog E OS=Arabidopsis thaliana E-value=5e-08; Cell division control protein 48 homolog D OS=Arabidopsis thaliana E-value=5e-08; Cell division control protein 48 homolog A OS=Arabidopsis thaliana E-value=5e-08;
Length 105 nt
Species Medicago truncatula
Belonged EST Libraries MT_DSTEM2;
Sequence GTGAAAGCAATCTAAGGAAGGCATTTGAGGAAGCTGAGAAGAATGCACCTTCCATCATCT
TTATTGATGAAATAGATTCCATAGCCTCCTAAGCGAGAGAAAACT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea)
Probeset
Corresponding NCBI Gene 831870 
Trichome-related Gene from Literature N/A