Detail of EST/Unigene AW693542 |
Acc. | AW693542 |
Internal Acc. | NF067D09ST1F1077 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase AtPK2/AtPK19 OS=Arabidopsis thaliana E-value=5e-74; Serine/threonine-protein kinase AtPK1/AtPK6 OS=Arabidopsis thaliana E-value=2e-73; Protein kinase 2 OS=Dictyostelium discoideum E-value=4e-57; RAC family serine/threonine-protein kinase homolog OS=Dictyostelium discoideum E-value=1e-50; Ribosomal protein S6 kinase alpha-6 OS=Homo sapiens E-value=1e-49; |
Length | 659 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CTCCGACAACAACAACTCTCTCTTCTTCCTCGACGAACTCACTTCCAACAGCGACGAAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04373 p90 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04373 p90 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04688 p70 ribosomal S6 kinase |
EC | 2.7.11.1 |
Transcription Factor Family | WRKY |
Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
Probeset |
|
Corresponding NCBI Gene | 820019 |
Trichome-related Gene from Literature | N/A |