Detail of EST/Unigene AW693657 |
Acc. | AW693657 |
Internal Acc. | NF066G06ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thiamine thiazole synthase 3, chloroplastic OS=Physcomitrella patens subsp. patens E-value=2e-22; Thiamine thiazole synthase 1, chloroplastic OS=Physcomitrella patens subsp. patens E-value=2e-22; Thiamine thiazole synthase 2, chloroplastic OS=Physcomitrella patens subsp. patens E-value=8e-22; Thiamine thiazole synthase 1, chloroplastic OS=Sorghum bicolor E-value=8e-22; Thiamine thiazole synthase 2, chloroplastic OS=Zea mays E-value=2e-21; |
Length | 359 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CACACTTCAGTTCATTGTAATAATTTCACATAAAAAATGGCTTCAGCTTCCACCACCATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835567 |
Trichome-related Gene from Literature | N/A |