| Detail of EST/Unigene AW693963 |
| Acc. | AW693963 |
| Internal Acc. | NF071A05ST1F1036 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thermospermine synthase ACAULIS5 OS=Arabidopsis thaliana E-value=5e-60; Spermidine synthase OS=Thermus thermophilus (strain HB8 / ATCC 27634 / DSM 579) E-value=1e-30; Spermidine synthase OS=Thermus thermophilus (strain HB27 / ATCC BAA-163 / DSM 7039) E-value=1e-30; Spermidine synthase OS=Thermoanaerobacter sp. (strain X514) E-value=9e-30; Spermidine synthase OS=Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E) E-value=9e-30; |
| Length | 616 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CTCTTTTCTCGTCTTCTTCTTCTTTCACACTTTCTCTTGTTCTGTTCTTTTTAGTTGTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00797 spermidine synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00797 spermidine synthase |
| EC | 2.5.1.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 832073 |
| Trichome-related Gene from Literature | N/A |