| Detail of EST/Unigene AW694331 |
| Acc. | AW694331 |
| Internal Acc. | NF075C04ST1F1033 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phosphoglycerate kinase, chloroplastic OS=Nicotiana tabacum E-value=2e-17; Phosphoglycerate kinase, chloroplastic OS=Triticum aestivum E-value=1e-15; Phosphoglycerate kinase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-15; Phosphoglycerate kinase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-13; Phosphoglycerate kinase, chloroplastic (Fragment) OS=Spinacia oleracea E-value=4e-13; |
| Length | 371 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CTCACACAAACACACTCTCTCTCTCTCTACAATGGCTTCAGCTACAGCCCCCACAACCAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842072 |
| Trichome-related Gene from Literature | N/A |