Detail of EST/Unigene AW694400 |
Acc. | AW694400 |
Internal Acc. | NF075H01ST1F1014 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71A1 OS=Persea americana E-value=4e-26; Cytochrome P450 71A4 OS=Solanum melongena E-value=2e-24; Cytochrome P450 71A2 OS=Solanum melongena E-value=4e-24; Cytochrome P450 71A6 (Fragment) OS=Nepeta racemosa E-value=7e-24; Cytochrome P450 71A27 OS=Arabidopsis thaliana E-value=2e-23; |
Length | 494 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | GAGAAACAATGGCTCTTAAAAAATGGTCACATGAACAAATTATAGGAGCTTTATCTTCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827771 |
Trichome-related Gene from Literature | N/A |