Detail of EST/Unigene AW694455 |
Acc. | AW694455 |
Internal Acc. | NF076E07ST1F1054 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 20 OS=Arabidopsis thaliana E-value=4e-68; Probable beta-1,3-galactosyltransferase 19 OS=Arabidopsis thaliana E-value=6e-47; Probable beta-1,3-galactosyltransferase 18 OS=Arabidopsis thaliana E-value=2e-44; Probable beta-1,3-galactosyltransferase 17 OS=Arabidopsis thaliana E-value=1e-40; Beta-1,3-galactosyltransferase 15 OS=Arabidopsis thaliana E-value=2e-08; |
Length | 587 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | AGGATTGAAGGCTTGGAAAGAAGTAGAAATGGTTGATGATAAGGAGATTGTAGAAAGCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827853 |
Trichome-related Gene from Literature | N/A |