Detail of EST/Unigene AW694507 |
Acc. | AW694507 |
Internal Acc. | NF076H09ST1F1079 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Plastidial pyruvate kinase 2 OS=Arabidopsis thaliana E-value=5e-42; Pyruvate kinase isozyme G, chloroplastic OS=Nicotiana tabacum E-value=2e-33; Plastidial pyruvate kinase 3, chloroplastic OS=Arabidopsis thaliana E-value=6e-31; Pyruvate kinase OS=Staphylococcus aureus (strain MW2) E-value=4e-16; Pyruvate kinase OS=Staphylococcus aureus (strain MSSA476) E-value=4e-16; |
Length | 654 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CCTCTCTACAACAATGTCTCAGGTTCGATCCATTCAAACCTCCTTCTCACGCCCCACTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00873 pyruvate kinase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00873 pyruvate kinase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00873 pyruvate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00873 pyruvate kinase |
EC | 2.7.1.40 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835369 |
Trichome-related Gene from Literature | N/A |