Detail of EST/Unigene AW694846 |
Acc. | AW694846 |
Internal Acc. | NF080G05ST1F1039 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferritin-2, chloroplastic OS=Vigna unguiculata E-value=1e-28; Ferritin-4, chloroplastic OS=Glycine max E-value=1e-26; Ferritin-2, chloroplastic OS=Arabidopsis thaliana E-value=3e-23; Ferritin-3, chloroplastic OS=Glycine max E-value=4e-23; Ferritin-2, chloroplastic OS=Nicotiana tabacum E-value=4e-23; |
Length | 526 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | ACCAAATCCAACATTTTCAGTTTCATTTCCCTCTGAATTTTCCTTTCTCTCCATTTTCGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.16.3.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820276 |
Trichome-related Gene from Literature | N/A |