Detail of EST/Unigene AW695007 |
Acc. | AW695007 |
Internal Acc. | NF082C09ST1F1069 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=4e-21; Glucan endo-1,3-beta-glucosidase 2 OS=Arabidopsis thaliana E-value=4e-20; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=7e-20; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform GLB OS=Nicotiana tabacum E-value=1e-19; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform GGIB50 OS=Nicotiana tabacum E-value=1e-19; |
Length | 560 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CTCACACTCACACTCATTCCATATCCCACCATGCATTGTATACTCATTCTTTCCATCCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815130 |
Trichome-related Gene from Literature | N/A |