Detail of EST/Unigene AW695019 |
Acc. | AW695019 |
Internal Acc. | NF082F03ST1F1029 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acylpyruvase FAHD1, mitochondrial OS=Dictyostelium discoideum E-value=2e-46; Acylpyruvase FAHD1, mitochondrial OS=Bos taurus E-value=2e-43; Uncharacterized protein ZK688.3 OS=Caenorhabditis elegans E-value=4e-41; Acylpyruvase FAHD1, mitochondrial OS=Homo sapiens E-value=2e-40; Acylpyruvase FAHD1, mitochondrial OS=Mus musculus E-value=3e-40; |
Length | 584 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | AGGAAGAGTACAGAGAAATGTCGACGGCGTCTTCCTGTCAGAAACTCTTTGATTTAGGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827276 |
Trichome-related Gene from Literature | N/A |