Detail of EST/Unigene AW695560 |
Acc. | AW695560 |
Internal Acc. | NF096E01ST1F1005 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Threonine dehydratase biosynthetic, chloroplastic OS=Arabidopsis thaliana E-value=8e-25; Threonine dehydratase biosynthetic, chloroplastic OS=Solanum lycopersicum E-value=4e-13; Threonine dehydratase, mitochondrial OS=Blastobotrys adeninivorans E-value=1e-08; Threonine dehydratase biosynthetic, chloroplastic OS=Cicer arietinum E-value=2e-08; L-threonine dehydratase biosynthetic IlvA OS=Pasteurella multocida (strain Pm70) E-value=4e-07; |
Length | 484 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CATGGAGGCGCTACGATTATCACAGCCACAACCTCACCTCCTCCTCCGTAACCACCGCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820166 |
Trichome-related Gene from Literature | N/A |