| Detail of EST/Unigene AW695560 |
| Acc. | AW695560 |
| Internal Acc. | NF096E01ST1F1005 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Threonine dehydratase biosynthetic, chloroplastic OS=Arabidopsis thaliana E-value=8e-25; Threonine dehydratase biosynthetic, chloroplastic OS=Solanum lycopersicum E-value=4e-13; Threonine dehydratase, mitochondrial OS=Blastobotrys adeninivorans E-value=1e-08; Threonine dehydratase biosynthetic, chloroplastic OS=Cicer arietinum E-value=2e-08; L-threonine dehydratase biosynthetic IlvA OS=Pasteurella multocida (strain Pm70) E-value=4e-07; |
| Length | 484 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CATGGAGGCGCTACGATTATCACAGCCACAACCTCACCTCCTCCTCCGTAACCACCGCCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820166 |
| Trichome-related Gene from Literature | N/A |